mmp 9 inhibitor  (MedChemExpress)

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 regulated MMP2, TGF-β1, SMAD2, and SMAD3 expression in MC3T3-E1 cells. MC3T3-E1 cells were pretreated with or without MMP9 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A and B ) MMP9, ( C ) MMP2, ( D ) TGF-β1, ( E ) SMAD2, and ( F ) SMAD3 was measured by qRT-PCR. ( G ) Protein expression of MMP9, MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( H ) phospho-SMAD2 and ( I ) phospho-SMAD3 in MC3T3 cells; scale bar 50 μm. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; t -test or ANOVA.

Article Snippet: MMP9 inhibitor (MMP-9-IN-1) and transforming growth factor-β1 (TGF-β1) inhibitor (Disitertide TFA) were purchased from MCE (USA).

Techniques: Expressing, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 downregulated MMP2 gene transcription through SMAD2/3. A , pGL-Luc-mMMP2-1387/+23 (p1387) was co-transfected with 100 ng pcDNA3.1-SMAD3 or pcDNA3.1-SMAD3 or pCDNA3.1. Transcription results were computed as luciferase activities per mg of total protein. The value obtained from the control group was considered as 1-fold. Fold increases were calculated by dividing the individual value by the control group. B , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad2. C , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad3. The data are reported as means±SD from independent experiments in triplicate. D , SMAD3 bound to -1368/-1348 in MMP2 promoter region. E , SMAD3 did not bind to -1271/-1251 in MMP2 promoter region. 32 P-labeled double stranded MMP2 probes were incubated with 5 μg of SMAD3 overexpressed cell nuclear extracts. The sequences selected for MMP2 probes are as follows: -1368 to -1348: ( 5'-CAAAGTCTTGTCTGAAGAGGA-3' ), -1271 to -1251: ( 5'-AACCAGAATGTCTGATTTTTA-3' ). Competition analysis of the SMAD3-MMP2 complex formation with 100-fold excess of unlabeled competitors or SBE site 1 mut ( 5'-CAAAGTCTAATTCAAAGAGGA-3' ) or SBE site 2 mut ( 5'- AACCAGAAAATTCAATTTTTA -3' ). Data are reported as means±SD. *P<0.05; ANOVA.

Article Snippet: MMP9 inhibitor (MMP-9-IN-1) and transforming growth factor-β1 (TGF-β1) inhibitor (Disitertide TFA) were purchased from MCE (USA).

Techniques: Transfection, Luciferase, Control, Labeling, Incubation

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 regulated RUNX2, OSX, ALP, COL I, and OCN expression in lipopolysaccharide (LPS)-induced MC3T3-E1 cells. After pretreatment with pcDNA3.1 or pcDNA3.1-mMMP9 for 48 h, MC3T3-E1 cells were stimulated or not with 20 μg/mL LPS and cultured for another 12 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, ( D ) SMAD3, ( E ) RUNX2, ( F ) OSX, ( G ) ALP, ( H ) COL I, and ( I ) OCN was measured by qRT-PCR. J , Protein expression of MMP2, TGF-β1, P-SMAD2, SMAD2, P-SMAD3, and SMAD3 was measured by western blot. K , Protein expression of RUNX2, OSX, ALP, COL I, and OCN was measured by western blot. Immunofluorescence analysis of ( L ) phospho-SMAD2 and ( M ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. N , Alkaline phosphatase (ALP) staining (a1-a3) and alizarin red S (ARS) staining (b1-b3). O , Quantification of ALP staining. P , Quantification of ARS staining. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Article Snippet: MMP9 inhibitor (MMP-9-IN-1) and transforming growth factor-β1 (TGF-β1) inhibitor (Disitertide TFA) were purchased from MCE (USA).

Techniques: Expressing, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence, Staining

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9-regulated MMP2 expression was inhibited by TGF-β1 or SMAD2/3 in MC3T3-E1 cells. MC3T3-E1 cells were pretreated in the presence or absence of TGF-β1 or SMAD2/3 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, and ( D ) SMAD3 was measured by qRT-PCR. E , Protein expression of MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( F ) phospho-SMAD2 and ( G ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. H , mRNA and ( I ) protein expression of MMP2 was measured by qRT-PCR and western blot. The data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Article Snippet: MMP9 inhibitor (MMP-9-IN-1) and transforming growth factor-β1 (TGF-β1) inhibitor (Disitertide TFA) were purchased from MCE (USA).

Techniques: Expressing, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence